Jurkat cell culture and stimulation

Jurkat T cells (clone E6-1) and Raji B (ATCC, CCL-86) cells were grown in RPMI 1640 SILAC medium with 10% FCS at 37 °C and 5% CO2 (SILAC Quantification Kit, Pierce). Jurkat cells were stimulated using anti-CD3 IgM (C305) and anti-CD28 IgM hybridoma supernatants in RPMI without FCS at 37 °C; stimulation was quenched after 10 min by the addition of ice-cold PBS, centrifugation (300 × g, 5 min, 4 °C), and subsequent shock-freezing of the cell pellets.

Generation of VAMP7-knockout in Jurkat cells

For the generation of sgRNAs the Atum online tool was used (https://www.dna20.com/eCommerce/cas9/input). The sgRNA oligos were then cloned into the pSpCas9(BB)-2A-GFP (PX458) vector (a kind gift from Feng Zhang [Addgene plasmid # 48138; http://n2t.net/addgene:48138; RRID:Addgene_48138]). Jurkat T cells (clone E6-1) were passaged to 0.125 Mio cells/ml the day before transfection. Five Mio cells were resuspended in 100 µl OptiMem with 10 µg pSpCas9(BB)-2A-GFP with the sgRNA CACCGCACACCAAGCATGTTTGGCA and electroplated with a NEPA21 electroporator (Nepagene) with the following settings: 0.2 mm gap electroporation cuvettes, poring pulse: 175 V, length: 5 ms, interval: 50 ms, number: 2, D. rate: 10%, polarity: +. After 48 h single clones were sorted by FACS for EGFP into 96-well plates. After the cells had recovered and grown the knockout was validated by western blotting and sequencing.

Lentiviral transduction of Jurkat cells

Once the VAMP7-knockout cell line was validated, the re-expression of VAMP7 constructs was performed. Wildtype VAMP7 and mutant VAMP7-C183A, both featuring FLAG-tags, were cloned into the lentiviral vector LegoiG2 (a kind gift from Boris Fehse [Addgene plasmid # 27341; http://n2t.net/addgene:27341; RRID:Addgene_27341])56. HEK293 cells were transfected with the constructs FLAG-VAMP7-WT-LegoiG2 or FLAG-VAMP7-C183A-LegoiG2 plus the third-generation packaging plasmids pMDLg/pRRE with pRSV-Rev and phCMV-VSV-G using lipofectamine. Supernatants containing viruses were harvested after 48 h and concentrated by centrifugation at 10,000 × g and 4 °C for 4–6 h in glass tubes. VAMP7-knockout Jurkat cells were transduced with the viruses by spinoculation, as described previously57. Cells were resuspended in lentiviral supernatant supplemented with Polybrene (6 µg/ml) and spun for 90 min at 37 °C at a speed of 800 × g. After 72 h the cells were sorted by EGFP expression via FACS. One week later the cells were sorted again for EGFP expression and also for the expression of CD3 and CD28 surface markers.

Construct design and cloning

Primary sequences of VAMP7, LAT, DHHC18, and DHHC20 were obtained from UniProt. Full-length constructs of VAMP7 and LAT were engineered bearing His6– and FLAG-tags, while DHHC18 and DHHC20 were designed with FLAG-tags alone, and ordered from Geneart. Truncated constructs of DHHC18 were generated by amplifying FLAG-tagged inserts via PCR. Mutagenesis was performed using the QuikChange Site-Directed Mutagenesis system (Agilent). Constructs were then cloned into the pFastBac1 vector of the Bac-to-Bac system (Thermo Fisher).

Insect cell expression and purification

Sf9 insect cells were grown in Sf-900 II medium (Thermo Fisher) at 27 °C. Baculoviruses were generated by transfecting insect cells with constructs in the pFastBac1 vector according to the Bac-to-Bac protocol. P4 viral stocks were then used to infect larger cultures, and expressed proteins were harvested 3–5 days following infection (~70–80% cell viability). Cell pellets were shock frozen and lysed in lysis buffer containing 50 mM NaH2PO4 (pH 7.2) (Roth), 300 mM NaCl (Roth), 0.2% Triton X-100 (Roth), 1 mM phenyl methanesulfonyl fluoride (PMSF) (Sigma), cOmplete protease inhibitor cocktail (Roche), and DNase (New England BioLabs) and RNase (Pancreac AppliChem) on ice for 30 min. Lysates were cleared by centrifugation (16,000 × g, 4 °C, 10 min.) and supernatants were loaded onto anti-FLAG M2 affinity gel (Sigma) at 4 °C. After washing, proteins were eluted using 0.1 M glycine at pH 3.5 and concentrated using Vivaspin spin filters (VWR) with appropriate MW cut-offs. After concentration, 0.08% n-dodecyl β-D-maltoside (DDM) (Sigma) and cOmplete protease inhibitor cocktail was added and constructs were dialyzed overnight at 4 °C into 50 mM NaH2PO4 (pH 6.5) and 10% glycerol (Roth). Protein concentration was determined by BCA assay (Pierce) and expression was confirmed by anti-FLAG western blot. Purified PATs were extremely sensitive to environmental conditions, precipitating at concentrations greater than ~5–10 µM and losing activity after freezing or 3–5 days storage at 4 °C. For this reason, all purified PATs were used immediately for the OPPA assays following dialysis.

Western blotting

To confirm the stimulation via phosphotyrosine and phospho-ERK1/2, and to confirm expression/purification of constructs expressed in insect cells, lysates were run on SDS-PAGE gels and transferred to nitrocellulose membranes using standard methods. Antibodies used for detection: 4G10 Platinum anti-phosphotyrosine (Millipore), anti-pERK (E-4) (Santa Cruz), anti-β-actin (AC-15) (Sigma–Aldrich), anti-LAT (Upstate (Millipore)), and anti-FLAG-HRP (Sigma–Aldrich). The self-produced VAMP7 antibody was a kind gift of Dr. Andrew Peden (The University of Sheffield, UK).

Acyl-biotin exchange

The ABE protocol was followed as described previously31,58. Briefly, stimulated Jurkat SILAC pellets were lysed in lysis buffer containing 50 mM Tris (pH 7.4) (Roth), 150 mM NaCl (Roth), 10 mM MgCl2 (AppliChem), 10 mM KCl (Sigma–Aldrich), 500 μM EDTA (Roth), 100 μM Na3VO4 (Sigma–Aldrich), 20 mM NEM (Thermo), 1 mM PMSF, 1.7% Triton X-100, 1 mM tris(2-carboxyethyl)phosphine (TCEP) (Sigma–Aldrich), 100 μM methyl arachidonyl fluorophosphonate (MAFP) (Sigma–Aldrich), and cOmplete protease inhibitor cocktail (PI-cocktail) on ice for 30 min. Lysates were cleared by centrifugation (16,100 × g, 4 °C, 10 min.). Chloroform-methanol (CM) precipitations were used between each chemical labeling step to ensure complete remove of unreacted reagents. The cleared lysates were subjected to a CM precipitation, then resuspended in buffer containing a 50 mM Tris (pH 7.4), 5 mM EDTA, 1% SDS (Roth), 125 mM NaCl, 1 mM PMSF, 0.2% Triton X-100, 20 mM NEM, and PI-cocktail and incubated overnight at 4 °C. NEM was then removed by three sequential CM precipitation steps, and enriched samples (e.g., heavy lysates) were resuspended in buffer containing 50 mM Tris (pH 7.4), 5 mM EDTA, 125 mM NaCl, 1% SDS, 574 mM hydroxylamine (HA) (Sigma–Aldrich), 820 µM EZ-Link HPDP-biotin (Thermo), 0.2% Triton X-100, 1 mM PMSF and PI-cocktail; control samples (e.g., light lysates) were resuspended in a similar buffer, omitting HA. After incubation for one hour at room temperature, a single CM precipitation removed HA, and samples were biotinylated in a buffer containing 50 mM Tris (pH 7.4), 5 mM EDTA, 125 mM NaCl, 164 µM EZ-Link HPDP-biotin, 0.2% Triton X-100, 1 mM PMSF, and PI-cocktail for 1 h at room temperature. Samples were then washed with three sequential CM precipitations and resuspended in buffer containing 50 mM Tris (pH 7.4), 5 mM EDTA, 125 mM NaCl, 0.1% SDS, 0.2% Triton X-100, 1 mM PMSF, and PI-cocktail. SILAC-labeled heavy and light samples were then mixed and allowed to bind to streptavidin-agarose beads (Novagen) for 90 min at room temperature. After four sequential washings, biotinylated peptides were eluted by cleaving the HPDP-biotin-cysteine disulfide linkage in a buffer containing 1% beta-mercaptoethanol (2-ME) (Roth) at 37 °C for 15 min. Eluates were precipitated via trichloroacetic acid (TCA) precipitation and resuspended in a smaller volume of SDS-PAGE sample buffer containing 0.2% Triton X-100, boiled for 5 min. at 95 °C, then run on a 4–12% Bis-Tris gel (NuPAGE Novex). After Coomassie staining, gels were used for in-gel tryptic digestion and subsequent LC-MS/MS. For the stimulated Jurkat cells, four individual ABE enrichments were performed (n = 4).

Quantitative LC-MS/MS and proteomic data analysis

Coomassie-stained gel lanes from the ABE enrichment were cut into 30 equal-sized bands and in-gel tryptic digest was performed as described previously31. Digested peptides were resuspended in 6 µl 0.1% (v/v) TFA and 5% (v/v) acetonitrile per band. Analysis of the peptides was performed via reversed-phase capillary liquid chromatography (Ultimate 3000 nanoLC system (Thermo Scientific)) coupled to an Orbitrap Elite mass spectrometer (Thermo Scientific). LC separations were performed on a capillary column (Acclaim PepMap100, C18, 3 μm, 100 Å, 75 μm i.d.×25 cm, Thermo Scientific) at an eluent flow rate of 300 nL/min using a linear gradient of 3–25% B after 53 min with a further increase to 80% B after 80 min. Mobile phase A contained 0.1% formic acid in water, and mobile phase B contained 0.1% formic acid in acetonitrile. Mass spectra were acquired in a data-dependent mode with one MS survey scan with a resolution of 60,000 (Orbitrap Elite) and MS/MS scans of the 15 most intense precursor ions in the linear trap quadrupole were used. Raw data have been deposited at the ProteomeXchange Consortium via the PRIDE partner repository59.

Identification and SILAC quantification were performed using MaxQuant software (version 1.4.1.1) with the Uniprot human protein database (2014 release). Proteins were filtered with the following criteria: (i) not identified only by site, reverse, or known contaminant (MaxQuant), (ii) at least one unique peptide, and (iii) at least two razor + unique peptides. The unstimulated Jurkat ABE enrichment we published earlier31 (n = 6) was reanalyzed using the following new procedure, allowing direct comparison to the stimulated Jurkat ABE dataset described here (n = 4). First, missing values were imputed with the median normalized heavy/light ratio of the specific LC-MS/MS run—in many cases this was very close to 1.0 (representing the background). H/L ratios were then transformed to log2 values and the mean H/L ratio and one-sample t-test p-values were calculated. Volcano plots were generated plotting the log2 fold-change to the −log10(p) value, giving rise to a pool of high-confidence palmitoylated proteins. It should be noted that the median coefficient of variance (CV) from the stimulated dataset is higher (92%) than that of the unstimulated dataset (65%). To validate the enrichment of palmitoylated proteins under both conditions in an orthogonal way, enriched pools were analyzed based on three criteria, described previously31: (i) previous reports in other palmitome studies, (ii) predicted palmitoylation sites (CSSPalm 4.0), and (iii) predicted TMDs (TMHMM 2.0)33,34.

OPPA

Purified targets (VAMP7, LAT) were diluted to 1 µM in buffer containing 50 mM NaH2PO4 (pH 6.5), 500 mM NaCl, 1 mM TCEP and 0.08% DDM. For each time point (0, 5, 10, and 20 min), the diluted target was divided into 12 wells (50 µl each) of a 96-well Ni-NTA-coated plate (Pierce) and allowed to bind for 1 h. Palmitic acid alkyne (PAA)-CoA was generated by preparing 50 mM Tris (pH 8.1), 14 mM MgCl2, 0.08% DDM, 0.1 mM EDTA, 1.6 mM ATP (Roth), 400 µM coenzyme A (Sigma), 40 µM PAA (Avanti), 0.05 UN/ml acyl-coenzyme A synthetase (Sigma) and 1% BSA (Sigma) and incubating at 37 °C for 1 h. This was diluted two-fold (yielding [PAA-CoA] ~20 µM) with 0.3–2 µM purified DHHC PAT (or 1 µM BSA for negative control) with 150 mM NaH2PO4 (pH 6.5), 300 mM NaCl and 0.08% DDM. Ni-NTA plates were washed four times with PBS + 0.05% Tween-20 (Sigma–Aldrich) (PBST) using a plate washer (Tecan) and 100 µl of the enzyme mixture was added. Reactions were carried out at 37 °C with shaking for designated time points, and the reaction was quenched by washing with buffer containing 50 mM NaH2PO4 (pH 6.5), 300 mM NaCl, 40 mM NEM and 0.1% Triton X-100. After the complete time course, plates were washed four times with PBST and click chemistry was performed by the addition of 50 µl buffer containing 50 mM NaH2PO4 (pH 6.5), 300 mM NaCl, and 1% Triton X-100. Click chemistry reagents were added as described previously60; briefly, to each 50 µl, the following reagents were added in this order, with vortexing between each step: 1 µl 1 mM biotin-azide (Thermo Fisher) in DMSO (Sigma), 1 µl 50 mM TCEP, 3 µl 16 mM Tris[(1-benzyl-1H-1,2,3-triazol-4-yl)methyl]amine (TBTA) (Sigma–Aldrich) prepared in 20% DMSO and 80% t-butanol (Sigma), and 1 µl 50 mM CuSO4 (Sigma). Click chemistry was performed at 37 °C for 3 h with shaking. After washing the plate six times with PBST, palmitoylated targets were eluted with 100 µl buffer containing 50 mM NaH2PO4 (pH 6.5), 300 mM NaCl, 1% Triton X-100, 1 mM EDTA and 200 mM imidazole (Roth) for 30 min at 37 °C. Eluates were transferred to high-binding plates (Greiner) coated for 3 h at room temperature with monoclonal anti-FLAG (Sigma–Aldrich) and blocked for 2 h at room temperature with 3% BSA and allowed to bind overnight at 4 °C with shaking. Plates were then washed six times with PBST and buffer containing PBS and 0.2 µg/ml Eu3+-streptavidin (PerkinElmer) and incubated at room temperature for 1 h. After washing eight times with PBST, fluorescence was measured in 120 µl enhancer solution (15 µM beta-naphthoyltrifluoroacetone (Sigma), 50 µM tri-n-cotylphosphine oxide (Sigma), 6.8 mM potassium hydrogen phthalate (Roth), 100 mM acetic acid (Roth) and 0.1% Triton X-100) using a plate reader (Victor3V, PerkinElmer) with excitation and emission wavelengths of 340 nm and 614 nm, respectively. All measured fluorescence values were normalized to both the t = 0 fluorescence value and the µg of protein (DHHC PAT or BSA) used in the reaction, and steady-state rates were calculated over the 20-min reaction time.

Immunofluorescence

Coverslips and dishes preparation: 12mmø coverslips (VWR, 631-0666) were precoated with 0.02% of poly-L-Lysine for 20 min at room temperature and were washed 3 times in water before being dried and kept for maximum 2 days. 100,000 cells were incubated on coverslips for 30 min in PBS.

Preparation of Jurkat T cells and Raji B cells conjugates: Raji B cells were washed, resuspended at a concentration of 1 × 106 cells/mL in RPMI without FCS and labeled with CellTracker™ Blue CMAC dye (10 µM, Thermo Fisher, C2110) for 20 min at 37 °C. Labeling was stopped with RPMI 10% FCS and cells were washed once and resuspended at 1 × 106 cells/mL. Cells were pulsed with SEE (100 ng/mL) or left untreated for 30 min at 37 °C before being washed once and resuspended at a concentration of 1 × 106 cells/mL. 100,000 Raji cells were incubated on coverslips for 30 min, washed once with warm PBS and 150,000 Jurkat cells resuspended in RPMI 10% FCS were added for 15 min. Coverslips were washed once with cold PBS before fixation.

Fixation: Cells were fixed with 4% paraformaldehyde (Life Technologies, FB002) for 15 min at room temperature, washed once in PBS and excess of paraformaldehyde was quenched for 10 min with PBS 10 mM glycine (Thermo Fisher Scientific, G8898). Coverslips were kept at 4 °C in PBS until permeabilization and staining.

Staining: Cells were permeabilized for 30 min at room temperature with PBS + 0.2% Bovine Serum Albumin (BSA, Euromedex, 04-100-812) and 0.05% Saponin (Sigma–Aldrich, S4521). Cells were then incubated for 1 h at room temperature with primary antibody, then washed three times with PBS 0.2% BSA 0.05% Saponin and incubated protected from light for 20 min in the same buffer with spun secondary antibodies. After washing once with PBS BSA Saponin, and once with PBS, coverslips were soaked three times in PBS, three times in water, and mounted on slides.

Mounting: For regular confocal microscopy, coverslips were mounted with 4–6 µL Fluoromount G (SouthernBiotech, 0100-01) on slides (KNITTEL Starfrost) and dried overnight protected from light before microscope acquisition.

Microscope: Images were acquired with a Leica DmI8 inverted microscope equipped with an SP8 confocal unit using either a ×40(1.35NA) or ×63(1.4NA) objective. Single plane images or Z-stack of images were acquired (pixel size around 60 nm).

Analysis of VAMP7 colocalization with Giantin: Z-stack (0.5 μm) images of similarly dimensioned Jurkat cells were chosen. In this z-stack, an ROI surrounding the Golgi was defined based on Giantin staining. Within each ROI, masks based on both Giantin and VAMP7 stainings were created by thresholding. Automatic colocalization assays were performed with Mander’s overlap coefficient, using the JACoP plugin for ImageJ64.

Antibodies: Anti-Flag (1/100) was from Sigma–Aldrich (F3165). Anti-Giantin (1/100) was produced by the recombinant antibody platform of the Institut Curie, Paris, France. Anti–rabbit Ig Alexa Fluor 488 (1/200) and anti–mouse Ig Alexa Fluor 568 (1/200) antibodies were from Thermo Fisher Scientific (A11034 and A11004 respectively).

Recruitment at the immune synapse and “Mean Cell” creation: Single images corresponding to the middle planes of conjugates were extracted from Z-stack. T cells were cropped and oriented in the same way regarding their synapse (script#1). Obtained T-cell images were grouped by condition (WT/C183A ± SEE) and fluorescence intensities were normalized by the mean fluorescence intensity (MFI). Images were then resized to the smallest image size in order to create a normalized stack of images for each group (script#2). All groups were normalized (size and intensity) before being compared. Stacks of aligned cells were finally projected (averaging method) giving single plane “mean cells” (script#3). Stacks were resized to obtain a 1-pixel height stack by averaging the fluorescence intensity of the total height of each image. Projections of the 1-pixel resized stacks were obtained based on average and standard deviation methods and pixel intensities profiles were performed along projections width (script#4). In order to get a cell-by-cell quantification, we also computed an enrichment ratio at the synapse. This enrichment was defined as the ratio between the total cell fluorescence and the fluorescence in the synaptic region (rectangle at the synapse representing 20% of the total cell). (script#3).

Statistics and reproducibility

The proteomic experiments of ABE-labeled experiments were performed with four biological replicates. Heavy/light SILAC ratios were calculated using MaxQuant software and mean values and one-sample t-test p-values were calculated for the volcano plot analysis. OPPA experiments were performed with n ≥ 12 technical replicates on each plate for each time point, and geometric means and standard errors of the mean were calculated for each condition.

Reporting summary

Further information on research design is available in the Nature Research Reporting Summary linked to this article.

Source